protein kinase pp38mapk Search Results


99
Cell Signaling Technology Inc anti pp38 mapk
Anti Pp38 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti pp38 mapk/product/Cell Signaling Technology Inc
Average 99 stars, based on 1 article reviews
anti pp38 mapk - by Bioz Stars, 2026-02
99/100 stars
  Buy from Supplier

90
Cell Signaling Technology Inc anti-pp38 mapk
Anti Pp38 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-pp38 mapk/product/Cell Signaling Technology Inc
Average 90 stars, based on 1 article reviews
anti-pp38 mapk - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

99
Cell Signaling Technology Inc 4370 cell signaling technology p38 mapk 9212 cell signaling technology pp38
4370 Cell Signaling Technology P38 Mapk 9212 Cell Signaling Technology Pp38, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/4370 cell signaling technology p38 mapk 9212 cell signaling technology pp38/product/Cell Signaling Technology Inc
Average 99 stars, based on 1 article reviews
4370 cell signaling technology p38 mapk 9212 cell signaling technology pp38 - by Bioz Stars, 2026-02
99/100 stars
  Buy from Supplier

99
Cell Signaling Technology Inc pp38 mapk t180 y182
Pp38 Mapk T180 Y182, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pp38 mapk t180 y182/product/Cell Signaling Technology Inc
Average 99 stars, based on 1 article reviews
pp38 mapk t180 y182 - by Bioz Stars, 2026-02
99/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology pp38 mapk
FIGURE 4. SM-induced hCSF ferroptosis activates p38 <t>MAPK</t> signaling. The hCSF exposed to mustard gas were accessed using qRT-PCR for p38 MAPK signaling. A significant increase in p38 MAPK mRNA transcription (A) was detected at eight hours (P < 0.01) and 24 hours (P < 0.001). MAP2Ks (B) that phosphorylate p38 MAPK increased at eight hours (P < 0.001) and 24 hours (P < 0.001). CHOP (C) a target of p38 MAPK increased at eight hours (P < 0.01) and 24 hours (P < 0.0001). An increase in caspase 9 (D) was detected at eight hours (P < 0.0001) and 24 hours (P < 0.0001) with a corresponding increase in caspase 3 (E) at 30 minutes (P < 0.05), eight hours (P < 0.001), and 24 hours (P < 0.0001). Finally, p53 (F) increased at 30 minutes (P < 0.001) and 24 hours (P < 0.0001). Data shown is from six primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. * P < 0.05; ** P < 0.05; *** P < 0.001; **** P < 0.0001
Pp38 Mapk, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pp38 mapk/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
pp38 mapk - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc pp38 mapk thr180 tyr182
FIGURE 4. SM-induced hCSF ferroptosis activates p38 <t>MAPK</t> signaling. The hCSF exposed to mustard gas were accessed using qRT-PCR for p38 MAPK signaling. A significant increase in p38 MAPK mRNA transcription (A) was detected at eight hours (P < 0.01) and 24 hours (P < 0.001). MAP2Ks (B) that phosphorylate p38 MAPK increased at eight hours (P < 0.001) and 24 hours (P < 0.001). CHOP (C) a target of p38 MAPK increased at eight hours (P < 0.01) and 24 hours (P < 0.0001). An increase in caspase 9 (D) was detected at eight hours (P < 0.0001) and 24 hours (P < 0.0001) with a corresponding increase in caspase 3 (E) at 30 minutes (P < 0.05), eight hours (P < 0.001), and 24 hours (P < 0.0001). Finally, p53 (F) increased at 30 minutes (P < 0.001) and 24 hours (P < 0.0001). Data shown is from six primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. * P < 0.05; ** P < 0.05; *** P < 0.001; **** P < 0.0001
Pp38 Mapk Thr180 Tyr182, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pp38 mapk thr180 tyr182/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
pp38 mapk thr180 tyr182 - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc rabbit anti pp38 mapk
FIGURE 4. SM-induced hCSF ferroptosis activates p38 <t>MAPK</t> signaling. The hCSF exposed to mustard gas were accessed using qRT-PCR for p38 MAPK signaling. A significant increase in p38 MAPK mRNA transcription (A) was detected at eight hours (P < 0.01) and 24 hours (P < 0.001). MAP2Ks (B) that phosphorylate p38 MAPK increased at eight hours (P < 0.001) and 24 hours (P < 0.001). CHOP (C) a target of p38 MAPK increased at eight hours (P < 0.01) and 24 hours (P < 0.0001). An increase in caspase 9 (D) was detected at eight hours (P < 0.0001) and 24 hours (P < 0.0001) with a corresponding increase in caspase 3 (E) at 30 minutes (P < 0.05), eight hours (P < 0.001), and 24 hours (P < 0.0001). Finally, p53 (F) increased at 30 minutes (P < 0.001) and 24 hours (P < 0.0001). Data shown is from six primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. * P < 0.05; ** P < 0.05; *** P < 0.001; **** P < 0.0001
Rabbit Anti Pp38 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti pp38 mapk/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
rabbit anti pp38 mapk - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc pp38 mapk
FIGURE 4. SM-induced hCSF ferroptosis activates p38 <t>MAPK</t> signaling. The hCSF exposed to mustard gas were accessed using qRT-PCR for p38 MAPK signaling. A significant increase in p38 MAPK mRNA transcription (A) was detected at eight hours (P < 0.01) and 24 hours (P < 0.001). MAP2Ks (B) that phosphorylate p38 MAPK increased at eight hours (P < 0.001) and 24 hours (P < 0.001). CHOP (C) a target of p38 MAPK increased at eight hours (P < 0.01) and 24 hours (P < 0.0001). An increase in caspase 9 (D) was detected at eight hours (P < 0.0001) and 24 hours (P < 0.0001) with a corresponding increase in caspase 3 (E) at 30 minutes (P < 0.05), eight hours (P < 0.001), and 24 hours (P < 0.0001). Finally, p53 (F) increased at 30 minutes (P < 0.001) and 24 hours (P < 0.0001). Data shown is from six primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. * P < 0.05; ** P < 0.05; *** P < 0.001; **** P < 0.0001
Pp38 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pp38 mapk/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
pp38 mapk - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc protein kinase pp38mapk
FIGURE 4. SM-induced hCSF ferroptosis activates p38 <t>MAPK</t> signaling. The hCSF exposed to mustard gas were accessed using qRT-PCR for p38 MAPK signaling. A significant increase in p38 MAPK mRNA transcription (A) was detected at eight hours (P < 0.01) and 24 hours (P < 0.001). MAP2Ks (B) that phosphorylate p38 MAPK increased at eight hours (P < 0.001) and 24 hours (P < 0.001). CHOP (C) a target of p38 MAPK increased at eight hours (P < 0.01) and 24 hours (P < 0.0001). An increase in caspase 9 (D) was detected at eight hours (P < 0.0001) and 24 hours (P < 0.0001) with a corresponding increase in caspase 3 (E) at 30 minutes (P < 0.05), eight hours (P < 0.001), and 24 hours (P < 0.0001). Finally, p53 (F) increased at 30 minutes (P < 0.001) and 24 hours (P < 0.0001). Data shown is from six primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. * P < 0.05; ** P < 0.05; *** P < 0.001; **** P < 0.0001
Protein Kinase Pp38mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/protein kinase pp38mapk/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
protein kinase pp38mapk - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

Image Search Results


FIGURE 4. SM-induced hCSF ferroptosis activates p38 MAPK signaling. The hCSF exposed to mustard gas were accessed using qRT-PCR for p38 MAPK signaling. A significant increase in p38 MAPK mRNA transcription (A) was detected at eight hours (P < 0.01) and 24 hours (P < 0.001). MAP2Ks (B) that phosphorylate p38 MAPK increased at eight hours (P < 0.001) and 24 hours (P < 0.001). CHOP (C) a target of p38 MAPK increased at eight hours (P < 0.01) and 24 hours (P < 0.0001). An increase in caspase 9 (D) was detected at eight hours (P < 0.0001) and 24 hours (P < 0.0001) with a corresponding increase in caspase 3 (E) at 30 minutes (P < 0.05), eight hours (P < 0.001), and 24 hours (P < 0.0001). Finally, p53 (F) increased at 30 minutes (P < 0.001) and 24 hours (P < 0.0001). Data shown is from six primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. * P < 0.05; ** P < 0.05; *** P < 0.001; **** P < 0.0001

Journal: Investigative ophthalmology & visual science

Article Title: Mustard Gas Induced Corneal Injury Involves Ferroptosis and p38 MAPK Signaling.

doi: 10.1167/iovs.66.1.23

Figure Lengend Snippet: FIGURE 4. SM-induced hCSF ferroptosis activates p38 MAPK signaling. The hCSF exposed to mustard gas were accessed using qRT-PCR for p38 MAPK signaling. A significant increase in p38 MAPK mRNA transcription (A) was detected at eight hours (P < 0.01) and 24 hours (P < 0.001). MAP2Ks (B) that phosphorylate p38 MAPK increased at eight hours (P < 0.001) and 24 hours (P < 0.001). CHOP (C) a target of p38 MAPK increased at eight hours (P < 0.01) and 24 hours (P < 0.0001). An increase in caspase 9 (D) was detected at eight hours (P < 0.0001) and 24 hours (P < 0.0001) with a corresponding increase in caspase 3 (E) at 30 minutes (P < 0.05), eight hours (P < 0.001), and 24 hours (P < 0.0001). Finally, p53 (F) increased at 30 minutes (P < 0.001) and 24 hours (P < 0.0001). Data shown is from six primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. * P < 0.05; ** P < 0.05; *** P < 0.001; **** P < 0.0001

Article Snippet: 5 p53 NM_001276761 AGGTTGGCTCTGACTGTA GTGTGATGATGGTGAGGATG 6 MAP2Ks NM_030662.4 GAAAGAGGCCAAGAGGATTC AAGCACCAGATCATGCAC 7 CHOP NM_001195054.1 ACTCTTGACCCTGCTTCT TCTGACTGGAATCTGGAGAG 8 p38 XM_002717471.3 CACGATCCTGATGATGAACC CCCTGCTTTCAAAGGACT 9 CAS3 NM_004346 CCACAGCACCTGGTTATT AAGCTTGTCGGCATACTG 10 CAS9 NM_001229 CGAACTAACAGGCAAGCA GTCTGAGAACCTCTGGTTTG Downloaded from iovs.arvojournals.org on 01/12/2025 quantified using Bradford assay (Cat no. 500006; Bio Rad Labs, Hercules, CA, USA) following reported methods.13 Western blotting was performed using antibodies specific for ɑSMA (Cat no. M0851; DAKO-Agilent, Santa Clara, CA, USA), p38 MAPK (Cat no. Sc-271120; Santa Cruz Biotechnology), and pp38 MAPK (Cat no. Sc-7973; Santa Cruz Biotechnology) as published previously.14 In brief, primary and secondary antibodies were used at 1:100 and 1:500 dilutions, respectively.

Techniques: Quantitative RT-PCR, Standard Deviation

FIGURE 6. Inhibiting p38 MAPK prevented mustard gas induced hCSF ferroptosis. The hCSF were pretreated with or without SB202190 to inhibit p38 MAPK activity then exposed to mustard gas. (A) Representative Western blot images. SB202190 significantly inhibited p38 MAPK phosphorylation (B) at 30 minutes (P < 0.001), eight hours (P < 0.0001), and 24 hours (P < 0.0001). The inhibi- tion of pp38 MAPK in hCSF significantly promoted cell viability (C) after mustard gas exposure at eight hours (P < 0.01) and 24 hours (P < 0.01). The addition of (+) shows treatment added to culture media. Data shown is from three primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. (Blue Bars = addition of SB202190 and Red = without SB202190.) (** P < 0.05; *** P < 0.001; **** P < 0.0001)

Journal: Investigative ophthalmology & visual science

Article Title: Mustard Gas Induced Corneal Injury Involves Ferroptosis and p38 MAPK Signaling.

doi: 10.1167/iovs.66.1.23

Figure Lengend Snippet: FIGURE 6. Inhibiting p38 MAPK prevented mustard gas induced hCSF ferroptosis. The hCSF were pretreated with or without SB202190 to inhibit p38 MAPK activity then exposed to mustard gas. (A) Representative Western blot images. SB202190 significantly inhibited p38 MAPK phosphorylation (B) at 30 minutes (P < 0.001), eight hours (P < 0.0001), and 24 hours (P < 0.0001). The inhibi- tion of pp38 MAPK in hCSF significantly promoted cell viability (C) after mustard gas exposure at eight hours (P < 0.01) and 24 hours (P < 0.01). The addition of (+) shows treatment added to culture media. Data shown is from three primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. (Blue Bars = addition of SB202190 and Red = without SB202190.) (** P < 0.05; *** P < 0.001; **** P < 0.0001)

Article Snippet: 5 p53 NM_001276761 AGGTTGGCTCTGACTGTA GTGTGATGATGGTGAGGATG 6 MAP2Ks NM_030662.4 GAAAGAGGCCAAGAGGATTC AAGCACCAGATCATGCAC 7 CHOP NM_001195054.1 ACTCTTGACCCTGCTTCT TCTGACTGGAATCTGGAGAG 8 p38 XM_002717471.3 CACGATCCTGATGATGAACC CCCTGCTTTCAAAGGACT 9 CAS3 NM_004346 CCACAGCACCTGGTTATT AAGCTTGTCGGCATACTG 10 CAS9 NM_001229 CGAACTAACAGGCAAGCA GTCTGAGAACCTCTGGTTTG Downloaded from iovs.arvojournals.org on 01/12/2025 quantified using Bradford assay (Cat no. 500006; Bio Rad Labs, Hercules, CA, USA) following reported methods.13 Western blotting was performed using antibodies specific for ɑSMA (Cat no. M0851; DAKO-Agilent, Santa Clara, CA, USA), p38 MAPK (Cat no. Sc-271120; Santa Cruz Biotechnology), and pp38 MAPK (Cat no. Sc-7973; Santa Cruz Biotechnology) as published previously.14 In brief, primary and secondary antibodies were used at 1:100 and 1:500 dilutions, respectively.

Techniques: Activity Assay, Western Blot, Phospho-proteomics, Standard Deviation

FIGURE 5. The p38 MAPK activation correlates with mustard gas induced ferroptosis. hCSFs exposed to mustard gas were subjected to live/dead assay for cell death and to western blotting to test phos- phorylated p38 MAPK to p38 MAPK ratio (pp38/p38). Cell death (A) significantly increased at 30 minutes (P < 0.001), eight hours (P < 0.0001), and 24 hours (P < 0.0001). Panel B shows represen- tative Western blot images. The pp38/p38 MAPK ratio significantly increased at 30 minutes (P < 0.001), eight hours (P < 0.0001), and 24 hours (P < 0.0001). The p38 MAPK activation had a direct time- dependent increase with ferroptosis in hCSF. Data shown is from six primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. *** P < 0.001; **** P < 0.0001

Journal: Investigative ophthalmology & visual science

Article Title: Mustard Gas Induced Corneal Injury Involves Ferroptosis and p38 MAPK Signaling.

doi: 10.1167/iovs.66.1.23

Figure Lengend Snippet: FIGURE 5. The p38 MAPK activation correlates with mustard gas induced ferroptosis. hCSFs exposed to mustard gas were subjected to live/dead assay for cell death and to western blotting to test phos- phorylated p38 MAPK to p38 MAPK ratio (pp38/p38). Cell death (A) significantly increased at 30 minutes (P < 0.001), eight hours (P < 0.0001), and 24 hours (P < 0.0001). Panel B shows represen- tative Western blot images. The pp38/p38 MAPK ratio significantly increased at 30 minutes (P < 0.001), eight hours (P < 0.0001), and 24 hours (P < 0.0001). The p38 MAPK activation had a direct time- dependent increase with ferroptosis in hCSF. Data shown is from six primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. *** P < 0.001; **** P < 0.0001

Article Snippet: 5 p53 NM_001276761 AGGTTGGCTCTGACTGTA GTGTGATGATGGTGAGGATG 6 MAP2Ks NM_030662.4 GAAAGAGGCCAAGAGGATTC AAGCACCAGATCATGCAC 7 CHOP NM_001195054.1 ACTCTTGACCCTGCTTCT TCTGACTGGAATCTGGAGAG 8 p38 XM_002717471.3 CACGATCCTGATGATGAACC CCCTGCTTTCAAAGGACT 9 CAS3 NM_004346 CCACAGCACCTGGTTATT AAGCTTGTCGGCATACTG 10 CAS9 NM_001229 CGAACTAACAGGCAAGCA GTCTGAGAACCTCTGGTTTG Downloaded from iovs.arvojournals.org on 01/12/2025 quantified using Bradford assay (Cat no. 500006; Bio Rad Labs, Hercules, CA, USA) following reported methods.13 Western blotting was performed using antibodies specific for ɑSMA (Cat no. M0851; DAKO-Agilent, Santa Clara, CA, USA), p38 MAPK (Cat no. Sc-271120; Santa Cruz Biotechnology), and pp38 MAPK (Cat no. Sc-7973; Santa Cruz Biotechnology) as published previously.14 In brief, primary and secondary antibodies were used at 1:100 and 1:500 dilutions, respectively.

Techniques: Activation Assay, Live Dead Assay, Western Blot, Standard Deviation

FIGURE 7. Inhibition of p38 MAPK in hCSF significantly reduced mustard gas–induced ROS production. The hCSFs were pretreated with or without SB202190 to inhibit p38 MAPK activity then exposed to mustard gas for 24 hours. The inhibition of pp38 MAPK in hCSF significantly reduced ROS production after mustard gas exposure (P < 0.05). Data shown is from three primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. * P < 0.05

Journal: Investigative ophthalmology & visual science

Article Title: Mustard Gas Induced Corneal Injury Involves Ferroptosis and p38 MAPK Signaling.

doi: 10.1167/iovs.66.1.23

Figure Lengend Snippet: FIGURE 7. Inhibition of p38 MAPK in hCSF significantly reduced mustard gas–induced ROS production. The hCSFs were pretreated with or without SB202190 to inhibit p38 MAPK activity then exposed to mustard gas for 24 hours. The inhibition of pp38 MAPK in hCSF significantly reduced ROS production after mustard gas exposure (P < 0.05). Data shown is from three primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. * P < 0.05

Article Snippet: 5 p53 NM_001276761 AGGTTGGCTCTGACTGTA GTGTGATGATGGTGAGGATG 6 MAP2Ks NM_030662.4 GAAAGAGGCCAAGAGGATTC AAGCACCAGATCATGCAC 7 CHOP NM_001195054.1 ACTCTTGACCCTGCTTCT TCTGACTGGAATCTGGAGAG 8 p38 XM_002717471.3 CACGATCCTGATGATGAACC CCCTGCTTTCAAAGGACT 9 CAS3 NM_004346 CCACAGCACCTGGTTATT AAGCTTGTCGGCATACTG 10 CAS9 NM_001229 CGAACTAACAGGCAAGCA GTCTGAGAACCTCTGGTTTG Downloaded from iovs.arvojournals.org on 01/12/2025 quantified using Bradford assay (Cat no. 500006; Bio Rad Labs, Hercules, CA, USA) following reported methods.13 Western blotting was performed using antibodies specific for ɑSMA (Cat no. M0851; DAKO-Agilent, Santa Clara, CA, USA), p38 MAPK (Cat no. Sc-271120; Santa Cruz Biotechnology), and pp38 MAPK (Cat no. Sc-7973; Santa Cruz Biotechnology) as published previously.14 In brief, primary and secondary antibodies were used at 1:100 and 1:500 dilutions, respectively.

Techniques: Inhibition, Activity Assay, Standard Deviation